Labguru · Schema

GeneBaseRequest

Electronic Lab NotebookELNLIMSLaboratory Information ManagementBiotechLife SciencesResearch Data ManagementInventory ManagementExperiment ManagementREST APIGraphQL

Properties

Name Type Description
token string
item object
View JSON Schema on GitHub

JSON Schema

GeneBaseRequest.json Raw ↑
{
  "$schema": "http://json-schema.org/draft-07/schema#",
  "$id": "https://raw.githubusercontent.com/api-evangelist/labguru/main/json-schema/GeneBaseRequest.json",
  "title": "GeneBaseRequest",
  "type": "object",
  "required": [
    "token"
  ],
  "properties": {
    "token": {
      "type": "string",
      "example": "YOUR TOKEN IS HERE"
    },
    "item": {
      "type": "object",
      "properties": {
        "title": {
          "type": "string",
          "description": "The name of the gene"
        },
        "alternative_name": {
          "type": "string",
          "description": "Alternative gene name."
        },
        "expression_location": {
          "type": "string",
          "description": "Location of gene expression."
        },
        "pathway": {
          "type": "string",
          "description": "Involved metabolic pathway."
        },
        "sequence": {
          "type": "string",
          "description": "Gene sequence.",
          "example": "ACTGACGACATGGTTCTGACCTGA"
        },
        "owner_id": {
          "type": "integer",
          "description": "id of the owner - by default it's your member id"
        },
        "source": {
          "type": "string",
          "description": "The origin or source from which the gene was obtained."
        },
        "description": {
          "type": "string",
          "description": "Detailed gene information."
        }
      }
    }
  }
}

Work with this as data

Every JSON Schema here is available over the APIs.io API and to AI agents over MCP.

MCP server

One button, every client — Claude, Cursor, VS Code and the rest.

https://apis.io/mcp

Tools for schemas

4 MCP tools reach this
  • find_json_schemasBrowse and filter every JSON Schema in the catalog.
  • apis_io_searchSTART HERE — APIs, providers and tags for one query, each with its total.
  • resolveTurn a domain, URL or GitHub org into the provider it belongs to.
  • find_cohortsEvery scored population of providers in the catalog.
All 92 tools →

Call it yourself

curl for this page
This JSON Schema
curl "https://apis.io/api/v1/json-schemas/GeneBaseRequest"
All schemas
curl "https://apis.io/api/v1/json-schemas?limit=25"

Discovery needs no key. Ratings and market analysis are Pro.

Get an API key

Free tier, no form to fill in. Signing in shares your email address with us — we store it to create your key and to recognise you if you sign in with another provider. See our Privacy Policy and Terms.

A second provider on the same verified email joins the account you already have.